by Dakota

Streptomyces avermitilis and Streptomyces coelicolor

June 23, 2014 in Posts by Dakota

 

Just a quick update that our donated strain samples are growing!  We don’t have an incubator so we’re making due with a room temperature dark cabinet, so while not optimal, it gets the job done.

We plated our samples of Streptomyces coelicolor and Streptomyecs avermitilis about a week ago, and it seems they have finally undergone formation of aeriel hyphae alongside production of the pigmented polyketide antibiotic actinorhodin (in the case of coelicolor).    One of the plates of coelicolor does not look the same as the other colonies though.  A purple color is being produced by the organism, and they have a much smoother/slimier look to the colonies.  Perhaps they are a day or two away of forming the fuzzy aeriel mycelia, or perhaps they are a mutant.   We will keep an eye on them.

We will be using them in our future work as part of a bio-assay for the compounds we are making.  The one picture of the brown pigment diffusing from the two colonies are those of S. avermitilis, the maker of avermectin.

IMG_1608IMG_1607IMG_1603IMG_1601

 

by Dakota

DNA Barcoding of fungal endophytes followed by DNA sequencing

June 20, 2014 in Endophytes, Posts by Dakota

So while we’re waiting for some reagents to come in for the synthesis of our first chemical product, I’ve been helping to run a class on the natural products of fungal endophytes.  Most of the work we’ve been doing the past few years on our own has been surrounding bio-active secondary metabolites originating from fungal endophytes, inspired mainly by the work of Dr. Gary Strobel of Montana State University.   One of our professors liked the idea enough to actually make it the main focus of one of her courses.  In exchange for our help and the use of some of our equipment, we get access to a University lab space and the associated perks that come with that, like consumables and access to machines we could never afford on our own like a UPLC, NMR, GC-MS and soon an LCMS.

It’s been rewarding, but also stressful at times, as trying to do molecular biology and microbiology in a chemistry lab is…difficult.  We’ve basically had to buy or borrow all the necessary equipment, and sometimes had to get creative.

Nevertheless, with a few setbacks like our -20C freezer failing and ruining all our reagents, we’ve been able to push forward to obtain some sequence data from the ITS (internal transcribed spacer) region of a few isolates the students have made.

The gel above is from students using a quick lysis method which entails a toothpick tip full of mycelia in water followed by incubation at 95C for 3 minutes, then ice until ready for use. The ladder used is a 1kb ladder from NEB. The first two lanes are +controls comparing previous DNA preps of a basidiomycete, followed by student samples.

Only three PCR products were observed on the gel, one being quite faint, in addition to the two controls.  The student who prepped the reaction in lane 7 and 8 seemed to have forgotten template DNA while overloading primer, and forgetting it in the 8th tube…which potentially explains the extremely bright primer cloud and absence of it in lane 8.

Nevertheless, we were still able to get some decent reads and contigs out of the data.

For the band in well 5 – it was a white filamentous ascomycete isolated from garlic.

The contig is as follows if one would like to nucleotide BLAST it.

>Ctg-CM-001
TAGGTGAACCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCC
TGTGAACATACCAATTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAA
CGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTC
TGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTT
CTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCA
GAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTAT
TCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGG
TTTGGTGTTGGGGATCGGCGAGCCCTTGCGGCAAGCCGGCCCCGAAATCT
AGTGGCGGTCTCGCTGCAGCTTCCATTGCGTAGTAGTAAAACCCTCGCAA
CTGGTACGCGGCGCGGCCAAGCCGTTAAACCCCCAACTTCTGAATGTTGA
CCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGG
AGG

It appears to be from Fusarium Proliferatum which, upon a quick morphological check and Google, seems to check out.  I guess that particular species is present as a plant pathogen in garlic bulbs according to google.  With few mycologists around, it’s been hard to positively ID via morphology many of the species.  I can only pick out with confidence Penicillium and Aspergillus species.  I have a better picture on my phone of the spores, but they look like long stretched out footballs and seem to match the spore shape of many fusarium.

95C 3 min initial denature

95C 30s denatration

52C 45s annealing

72C 1 min elongation

Repeat 34x

72C 5 min final elongation

1 uL crude template

2uL ITS1 / ITS4 10uM primer master mix

12.5 uL 2x  Taq NEB Master Mix

9.5 uL water

—–

5uL PCR rxn load onto a 1% agarose gel stained with GelGreen

The other contigs follow below.

>Ctg-CM-002
TCCGTAGGTGAACCTGCGGAGGGATCATTATCGAGTTATTCAACTCCCAA
ACCCTATGTGAACTTACCACTTGTTGCTTCGGCGCGCGCTTCGGCGCCGC
CGAGGACACTTAAACTCTTTGTTTTTATAAGCATTTCTGAGTGGCCGAAA
GGCAAAAATACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCT
GGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGA
ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTC
TGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCCGACTCTT
TTGAGGACGGCTCGGCGTTGGGGGACGGCAGACTCCCCCCGGCATCTCGC
CGGGGACGCCGCCCCCGAAATCTAGTGGCGGCCCTCCGAGGCGACCTCTG
CGTAGTAACTTGTTCTCGCACCGGAAAGCTCAGAGCGGCCACGCCGTAAA
ACCCCAACTTTTTTCAGGTTGACCTCGAATCAGGTAGGACTACCCGCTGA
ACTTAAGCATATCAATAAGCGGAGG

>Ctg-CM-003
TCCGTAGGTGAACCTGCGGAGGGATCATTATCGAGTTATTCAACTTCCAA
ACCCTATGTGAACTTACCACTTGTTGCTTCGGCGCGCGCTTCGGCGCCGC
CGAGGACACTTAAACTCTTTGTTTTTATAAGCATTTCTGAGTGGCCGAAA
GGCAAAAATACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCT
GGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGA
ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTC
TGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCCGACTCTT
TTGAGGACGGCTCGGCGTTGGGGGACGGCAGACTCCCCCCGGCATCTCGC
CGGGGACGCCGCCCCCGAAATCTAGTGGCGGCCCTCCGAGGCGACCTCTG
CGTATTAACTTGTTCTCGCACCGGAAAGCTCAGAGCGGCCACGCCGTAAA
ACCCCAACTTTTTTCAGGTTGACCTCGAATCAGGTAGGACTACCCGCTGA
ACTTAAGCATATCAATAAGCGGAGG

>Ctg-CM-004
GGGGCGCGTCCCGTAGGGGACGGCACCCATCACACAAGCCGGGCTTGAGG
GTTGCAAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGAGGGCGC
AATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTA
CTTATCGCATTTCGCTGCGTTCTTCATCGATGCTGGAACCAAGAGATCCG
TTGTTGAAAGTTTTAATGATTAAATATAATC

>Ctg-CM-005
ATCCGAGGTCAAGACGGTAATGTTGCTTCGTGGACGCGGGCCGCGCACCT
CGAGAAGCGCAATGTGCTGCGCGAGAGGAGGCAAGGACCGCTGCCAATGA
ATTTGGGGCGAGTCCGCGCGCAGAGGCGGGACAGACGCCCAACACCAAGC
AGAGCTTGAGGGTGTAGATGACGCTCGAACAGGCATGCCCCATGGAATAC
CAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCA
ATTCACACTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAGCC
AAGAGATCCATTGTTGAAAGTTGTAACGATTGTTTGTATCAGAACAGGTA
ATGCTAGATGCAAAAAAAGGTTTTGATAGGTTCCAACGGCAGGTTGCCCC
GCCGAAGGAGAACGAAAGGTGCTCGTAAAAAAAGGATTCAGACATGCGGC
GCGTGAAAGTGTTACCTCTACCGCCCGACGGCAGCTGTTGCTCCCGCCGA
GGGCCGCGACCGCACCTCATGGAATAGATAATGATCCTTCCGCAGGTTCA
CCTACGGA

>Ctg-CM-006
CCGTAGGTGAACCTGCGGAGGGATCATTACTGAGTTACCGCTCTATAACC
CTTTGTGAACGTACCTAACCGTTGCTTCGGCGGGCAGGGGAAGCCTCTCG
CGGGCCTCCCCTCCCGGCGCCGGCCCCCACCACGGGGACGGGGCGCCCGC
CGGAGGAAACCAAACTCTATTTACACGACGTCTCTTCTGAGTGGCACAAG
CAAATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGA
AGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAAT
CATCGAATCTTTGAACGCACATTGCGCTCGCCAGCATTCTGGCGAGCATG
CCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGTTTTGGGGCCC
CACGGCCGACGTGGGCCCTTAAAGGTAGTGGCGGACCCTCCCGGAGCCTC
CTTTGCGTAGTAACTAACGTCTCGCACTGGGATCCGGAGGGACTCTTGCC
GTTAAACCCCCAAATTCTTTACAGGTTGACCTCGGATCAGGTAGGAATAC
CCGCTGAACTTAAGCATATCAATAAGCGGAGG

>Ctg-CM-007
CCGTAGGTGAACCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAAC
CCCTGTGAACATACCTTTATGTTGCCTCGGCGGATCAGCCCGCGCCCCGT
AAAACGGGACGGCCCGCCGCAGGAAACCCTAAACTCTGTTTTTAGTGGAA
CTTCTGAGTATAAAAAACAAATAAATCAAAACTTTCAACAACGGATCTCT
TGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAA
TTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCC
AGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCC
AGCTTGGTGTTGGGATCTGTCTTCACTGACAGTCCTCAAATTGATTGGCG
GTCACGTCGAGCTTCCATAGCGTAGTAATTTACACATCGTTACTGGTAAT
CGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATC
AGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGG

by Dakota

Cultivate friendship and do cool science

June 11, 2014 in Posts by Dakota

So the past two weeks have been pretty crazy, in a good way.  I’ve managed to meet up with people from MIT, BOSSLab, and a few local biotechs on the North Shore.  It’s been strange not having to wake up to go to a 9-5.  I wouldn’t say it’s good, because distractions abound, but I was able to meet more people in two weeks in regards to pure science and business development than I ever had in a year prior.  I suppose a 9-5 for someone else is equal to a 9-midnight job you do for yourself.  Being able to meet at any time and anywhere is a good thing when it comes to progressing an entrepreneurial endeavor.  Not being payed while you meet these people, though, is the downside.   I can live with raman noodles and rainwater for now though.

Some people can pull off starting a side-business while working their main job, but I found that starting DNA extractions and PCR’s at 8 pm just wasn’t fun, couple that with spending the weekends in the lab and you felt like you weren’t even living life for someone in their twenties.  Hard work is important, yes, but hard work and torture are two different things.  We only get a finite amount of time on this planet and it can’t all be spent reading journal articles and running gels…human interaction is important to happiness and sanity.

I’d venture to say that starting a biotech company is not something that is easy to moonlight.  Wittling soap into gnomes for beer money might be something you can pull off in your spare time, but multi-step organic synthesis is not.

20140605_181200

We managed to acquire from T.K. an Eppendorf 5417C centrifuge along with some unique bacterial strains for use in a current project.  I have no idea how people feel about their name being used on the internet so I will bypass naming and use just initials.  We also managed to acquire from A.L. the parts for the Lightbulb PCR machine which had been developed over the past year at http://tequals0.wordpress.com/  and http://bosslab.org/

K.G. hooked it up with some E. Coli strains including a ccDB toxin/antitoxin containing strain.

All in all it has been a good two weeks.  Met a lot of really interesting people all doing really inspiring work.  I hope one day we’ll all make it big, and if only one of us make sit big, they’ll help the rest of us out!

But in all seriousness, the point of this post wasn’t just a quick update, but it was to mention the importance of human interaction in achieving what it is you want to achieve.  Humans, by nature, want to help each other.  You’d think if natural selection had its way, everything would be out to kill everything else, but that’s not the way it turned out.  People feel good helping one another, and rightly so.  We are all in this struggle together on Earth, each awkwardly living our own life trying to make it better for ourselves, our friends, and our family…and hopefully strangers once in a while.

So if there is one piece of advice I could give you if you are trying to start your own company, or even just living your life day to day, it would be to cultivate friendship and cultivate kindness.  Random acts of kindness go a long way.   Do something because it is the right thing to do, not because you hope for a reward.

Also attached are random pictures of us making some growth media for transformation experiments, followed by my strain cultivation of three different kinds of oyster mushrooms; king oyster, golden oyster, blue oyster…and last but not least the boxes that contained our $1,200 set of reagents from NEB for our future experiments.  SCIENCE TIME BABY

IMG_1499 IMG_1447 IMG_144620140605_180452


by Dakota

Quitting my job to start a biotech company in the basement

May 16, 2014 in Posts by Dakota

So after years upon years of talk, planning, more talk, and more empty promises to myself and others, I finally took a leap of faith.  At a certain point, you realize that there isn’t anymore time for planning and writing down ideas, action needs to be taken.  Many people, myself included, have let this unattainable goal of  “perfection” completely ruin pursuing dreams and business opportunities.  I’ve come to the conclusion that nothing will ever be perfect.  A product will never be perfect, the timing for entering a market will never be perfect, and perhaps execution of a well written business plan will never be perfect, but that should not deter one from trying.

Many people fear leaving their comfort zone, I know I did, and still do.  It’s easy to become complacent in the comfort of stability and normalcy.  You go to work, get a paycheck, maybe get to travel for a week or two a year, have the weekends off, and everything seems fine.  Some people are perfectly happy living like that, I’m not.  I’d rather sleep in a van and eat raman noodles for a year if it meant a shot at achieving my dreams and goals.

Certain sacrifices no doubt will be made, nights out with friends will now be nights in spent with Excel calculating profit margins and shipping expenses.  That weekend canoe trip with your buddies will be that weekend of experiments in a cramped lab space with no air conditioning, praying for a product yield above 10%.  While your girlfriend sips from a $5 bottle of triple distilled water, you sip from the rainwater you collected last night in an empty cup you found in the dumpster behind Arby’s.

But someday, when you look back at your life in one year, ten years, or fifty years, you’ll be able to say without regret that you took a shot, and that’s more than a lot of people can say.

I guess many people question what it is they want to do in life after finishing college and working for a year or two.  All of a sudden this giant weight which is reality starts to rest on your shoulders, and you realize as each year passes that you haven’t done 1% of all the cool things you had hoped to be doing when you were planning your life for your future self in middle school or high-school.    That trip across the country never happened, backpacking through Europe became backpacking in the woods behind your house with a 30-pack, and winning the Nobel prize while simultaneously becoming a billionaire before 30 doesn’t look like it’s going to happen.

I still have a few years left for that last challenge though…

I plan on documenting the journey via a series of videos, as well as keeping track of how I spend my time, in the hopes that one day it might be of use for someone else.  There are plenty of stories out there of people’s successes, and even failures, but not many people talk about the nitty gritty in between time.  That period of purgatory where you are in limbo between becoming a successful validated business, or disappearing into nothingness.

We’ll see how far the science gets us in our journey, so for now stay tuned for more content, including videos and write-ups about what it is we are actually working on and what we hope to accomplish.

by Dakota

Endophyte isolation followup

August 12, 2013 in Posts by Dakota

 

A few samples were selected for hyphal tipping and pure culture isolation.  Shown, in no particular order, are some of the samples to be taken and re-plated on fresh PDA.   Small pieces of the mycelia were excised with a sterile scalpel and placed in the center of fresh plates.  In some instances, like the dark red pigmented colony growing within a few others, hope of a perfectly pure inoculum wasn’t expected, and instead we were just interested to see what might grow on the plate.

IMG_1228 IMG_1231 IMG_1222 IMG_1235 IMG_1244

IMG_1245

IMG_1234 IMG_1223 IMG_1229 IMG_1236

 

 


 

 

 

 

 

 

 

 

 

 

 

There were instances like the first picture, in which a very homogeneous mycelial mass was obtained, which looks like a pure culture isolation.  We will perform DNA isolation and ITS amplification on some of the select organisms, as well as observe some of them under the microscope.  This week, agar plugs of pure strains will be put into liquid broth to ferment, with the downstream goal of processing the fermentation broth to isolate a crude extract of secondary metabolites to be used for bio-assay guided fractionation.

IMG_1267 IMG_1282 IMG_1285 IMG_1279 IMG_1277 IMG_1273 IMG_1272 IMG_1271 IMG_1269 IMG_1286

by Dakota

Down n’ Dirty sequencing

August 6, 2013 in Posts by Dakota

We’ve done enough PCR on fungal cultures and samples to know that our PCR program, enzymes, and primers are working as intended.  In order to give us confidence in the ITS amplification of  unknown endophytic fungal samples, we wanted to amplify a known species and confirm that we can get clean sequencing reads.

We performed a DNA extraction using our homemade buffers and an  isopropanol precipitation  followed by a 50uL PCR reaction.

PCR reaction conditions are as follows:

3uL template

2 uL ITS master mix (ITS1F, ITS4R – see older posts for primer sequences)

25uL NEB Taq Master Mix

20uL water

 

IMG_1143 IMG_1137

 

 

 

 

 

After the reaction was run, a 1% agarose gel was cast, and 5uL of the PCR reactions were loaded, alongside a 1kb NEB ladder.  https://www.neb.com/products/n3232-1-kb-dna-ladder

Lanes were as follows:

1 – NEB 1kb ladder

2 – + control

3 – Sample 1

4 – Sample 2

5 – Sample 1 genomic DNA (5uL load)

fungal PCR gel

 

~40 uL was withdrawn from the sampletube taking care not to get mineral oil, and processed with an Epoch Life Science PCR purification spin kit.

http://www.epochbiolabs.com/pcrcleanup.asp?pageName=products

Eluted DNA and a fresh set of primers were sent for sequencing, although due to very odd circumstances, only Lane 4 (faint band at ~700 bp) arrived.

Sequencing was provided by Wyzer Biosciences in Cambridge, MA  https://www.wyzerbio.com/wiser/#aboutUs

We highly recommend them!  They went above and beyond in order to assure we got quality sequencing data as well as went out of their way to personally call us and discuss sequencing parameters after our primers did not arrive, even with a sample order size of two.  The company is run by fantastic people and is well worth supporting.

Here are the FASTA files as follows.

>23331_2_PR-002_141272_00 4D1000002363964D
NNNNNNNNNNNNNNNNNNNNNCNGNNTTGAGGTCAGCATTCAAGAANTTG
TCCTTAGACGATTAGAAGCTGAACATCAGAAAGCAATCCCCTCGCCAGTG
TAGATAAGTTATCACACTTGTGGCAGATCGCAGACGATTCCGCTAATGCA
TTTCAGAGGAGCTGACCCCAAGTAAGGAGCCAGCAAACCTCCACAATCCA
AGCTCTCCTTTACAACAAAGTATTGGAGAGTTGAGAATATAATGACACTC
AAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGATGCGTTCAAAGA
TTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCT
GCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTAT
AATAATTTTCATAGGCATAGCCCATGTAAAGACATTCAATGACATTCTAA
GAGTATAATGAATAACATAGACTCTAACAGGAAAAAGATTCCATGGCCAA
GGTAAAGGACAGCACTGTTTTCACACTGCAAGTCCTTACATCCAGCAAAG
AGCTGATAGGCTGACCACTTCCTCCAATACCTGAAAAAGACTACAAAAGG
TGCACAGGTGGATGAAAATGAAGTCCAGACAGGCGTGCACATACTCCGAA
GAGCCAGCTACAACCCATCTAGAAAACATAATTCAATAATGATCCTTCCG
CAGGTTCACCTACGGAA

>23331_2_PR-002_141269_00 4D1000002358244D
NNNNNNNNNNNNNNNNNNNNANNTGGGTTGTAGCTGGCTCTTCGGAGTAN
GTGCACGCCTGTCTGGACTTCATTTTCATCCACCTGTGCACCTTTTGTAG
TCTTTTTCAGGTATTGGAGGAAGTGGTCAGCCTATCAGCTCTTTGCTGGA
TGTAAGGACTTGCAGTGTGAAAACAGTGCTGTCCTTTACCTTGGCCATGG
AATCTTTTTCCTGTTAGAGTCTATGTTATTCATTATACTCTTAGAATGTC
ATTGAATGTCTTTACATGGGCTATGCCTATGAAAATTATTATACANCTTT
CANCAACGGATCTCTTGGCTCTCGCATCNATGAANAACNCNNCGNANNNN
NATAANNNNTGNNNNTTGCANANNTCNNNGNTCNTCAAANNNTTNAANNN
TNTTGCGCTNNNNGNNANTCNNANNANNN

Put them into

http://blast.ncbi.nlm.nih.gov/

dd2f41d6a39848cb905f1b93b4a39a4d

 

Our sequencing chromatograms looked good, with one giving a read of over ~700 bases, while the other was cut short at ~400 bases.  Nevertheless, for a first try the very crude attempt at sequencing went better than expected, and enough data was retrieved to give a greater than 99% confirmation on the sample sequenced via BLAST. We did indeed do ITS amplification of Agaricus Bisporus, and the sequencing data confirms that our protocols for DNA isolation, amplification, and purification are working as intended, and lend confidence to future endeavors in the identification of unknown fungal endophytes.

 

by Dakota

Basic endophyte isolation – testing the lower limits of aseptic technique

August 5, 2013 in Posts by Dakota

In the quest to isolate new endophytic fungi and build a strain library for screening, one of the main issues we face is still being unable to afford a laminar flow hood.  Sterility is a big concern in endophyte isolation, as it is very important to assure that any microorganisms found in the petri dish are coming from within the plant tissue, not on it, or outside of it.  A quick google search will return many home-built laminar flow hoods as well as more simple versions such as a “sterile hood” which consists of a fish tank or plastic container turned on its side and cleaned thoroughly with bleach/isopropyl alcohol.

In this experiment, we wanted to test the bare minimum (ie, no laminar flow hood, no make-shift sterile hood) and see if we could get a control with no growth and samples that looked like endophytic fungi were growing from them.

Samples were taken from:

English Ivy http://en.wikipedia.org/wiki/Hedera_helix

Rhododendron http://en.wikipedia.org/wiki/Rhododendron (only the fresh leaf was plated, the damaged batch of small leaves and stems were discarded)

Ginko http://en.wikipedia.org/wiki/Ginkgo and a few leaves with small branches/stems were selected from each.

Samples were washed for 30s under tap water, then cut into small sections and placed in 5% sodium hypochlorite for 30s, followed by 70% ethanol for 30s, followed by two sterile water washes for 30s each.  100uL of the final water wash was plated as the control.

IMG_1174

IMG_1177IMG_1175

Afterwards, samples were plated on PDA (potato dextrose agar) supplemented with chloramphenicol to inhibit bacterial growth,and left in a dark cabinet at room temperature after being sealed with parafilm.

IMG_1191IMG_1190IMG_1189IMG_1188 IMG_1186 IMG_1185 IMG_1184

 

 

 

 

 

 

 

 

 

 

 

Fast forward a week and here are how the plates look

IMG_1207

IMG_1205 IMG_1196 IMG_1197 IMG_1203 IMG_1202 IMG_1201 IMG_1199 IMG_1200

 

 

 

 

 

IMG_1216IMG_1215\

 

 

 

 

 

 

 

 

 

We’ll work on a follow up post on how the samples were re-plated via hyphal tipping to try to get pure cultures, but the good news is, the control doesn’t have any growth!  Also, on the Rhododendron leaf stem (the last two pictures) you can see the white mycelium growing out of the vascular tissue, pretty cool! In some of the cases, like leaving the outer bark on the ginko stem, contamination from epiphytes/ectophytes will occur, but it is still interesting observing the organisms grow.

There was at least one yeast colony on one of the ginko leaves, and a few samples were selected to re-plate to try to get pure cultures.  Ideally, we’d be observing the growth of the organisms daily and taking note of their growth rates, coloration, and other features, but we both have 9-5′s and sometimes cannot always get to the lab every day.  The Ivy sample was interesting to look at, but mostly discarded for further isolation because of the density of growth of the organisms.

Needless to say, it seems that with a little bit of practice and a very crude aseptic technique, you can isolate some endophytes of your own.

 

by Dakota

Turning failure into success

June 11, 2013 in Posts by Dakota

IMG_1012

After many gels that looked like the picture above, with only primer dimers, we had to reconsider our approach to PCR.

Often times in the sciences, experiments don’t go as planned, and what we’ve come to learn is that it is incredibly important how you handle those situations, as neglecting sources of error can lead you on a hunt for variables that may or not be important. You could opt to ignore the results as a fluke and blindly repeat the same experiment, wasting time and consumables, or approach the problem in a scientific manor.

In our particular case, the one thing we were varying perhaps a little too much was the way we went about genomic DNA isolation.

We had had success with a plant genomic DNA spin kit on fungal samples, but with a ~20-30 minute processing time per sample and cost of ~$1.50 we looked to something faster and less expensive.

Previously, we had had success with a crude colony PCR approach mentioned in one of our previous posts, which basically involved grinding mycelia in 50mM NaOH. The buffer the Taq came in seemed to handle the pH change fine and we got amplification. On subsequent tries though, our results were inconsistent, with some colonies yielding successful amplification, and others yielding nothing but primer dimers. The mass of initial mycelia to be ground as a sample seemed to have a big impact on the results of amplification. A petri dish covered in what looks like a mass of mycelium results in little more than a few milligrams when scraped into a concentrate.

IMG_1018
You can see previous wound marks on our colonies being sampled from the fungal colony.

We had a few more failed gels, at times blaming old polymerase, bad primers, freeze thaw cycles, a poor PCR program, and even the water we were using.   After doing a few runs where we caught ourselves varying too many things, thus making the task of narrowing down the source of error that much harder, we finally came to our senses and realized we couldn’t brute force our way into successful PCR, and that instead, a little extra time spent planning the experiment would save time, materials, and frustration in the long run.

 

We were finally able to point the finger at poor template DNA (or lack there-of in some cases) and realized that although colony PCR might work pretty consistently for bacteria, it was not giving reproducible results for non-yeast filamentous fungi.

After doing some research online for protocols involving rapid DNA isolation from fungal colonies, we happened upon a paper which seemed to present good results while using cheap and readily available materials, and gave it a shot.

We kept all other variables the same (PCR program, polymerase, primers) and did extractions with our new solutions on multiple fungal samples, with the results below.

photo (1)

 

Lanes are as follows:

  • 1kb ladder
  • Porchini mushroom
  • Portabella mushroom
  • Shitake mushroom
  • Maitake mushroom
  • Enoki mushroom
  • King Oyster mushroom
  • Crimini mushroom
  • White button mushroom
  • 1:2 primer dilution
  • 1:4 primer dilution
  • 1:2 template DNA dilution
  • 1:4 template DNA dilution
  • positive control
  • negative control
  • plant samples PCR (failed)
  • plant sample PCR (you can see a faint band)
  • empty
  • empty

This was one of our most successful PCR reactions and we were quite happy with it as it was a validation of our efforts in trying to optimize conditions for fungal DNA amplification as well as fungal DNA isolation.  The DNA isolation procedure worked on seven of the eight mushroom samples, though judging by the intensity of the primer dimers on the one lane that didn’t have an amplification product, it looks like template DNA was simply missing in that particular case, rather than just a poor isolation.  We were also able to see just how big of an impact primer concentration can have on PCR, as the bands lose much of their intensity at just a 1:2 dilution, and disappear with a 1:4 dilution, yet diluting by the same amount with the template DNA almost looks as if it improved amplification in the 1:2 dilution, and band intensity seemed unchanged in the 1:4 dilution.

Not bad for a couple of chemists.

 

by Jake

Honing in on fungal DNA barcoding

April 23, 2013 in Posts by Jake

We have successfully shown that we are able to barcode an unknown fungal sample, but the question now is, can we reproduce it? We have gathered the necessary tools and now face the task of making sure that our protocols are thorough, easy to follow and most importantly, reproducible. Over the past week we have ran ~28 reactions (DNA extraction, PCR, isolation). Unfortunately, what we have found is that our protocol is not as robust as we were hoping.

Samples 1 to 3 are DNA extractions from the same fungal colony using 3 different DNA extraction solutions. All used ITS primers (see below for primer sequences).

Sample 1 used an extraction solution of Tris-HCl, EDTA and SDS.
Sample 2 used 20mM NaOH
Sample 3 used 20mM KOH.

Samples 4 and 5 are DNA extractions from the same plant sample using Epoch Life Sciences Plant Genomic DNA Extraction Kit (Cat # 1560050).

Sample 4 used primer set LEP
Sample 5 used primer set rbcLA

Sample 6 used primer set rbcLA and a plant template extracted using 80mM NaOH

Sample 7 used fungal DNA extracted using 80mM NaOH and ITS primers

So what do we think is going on?

As for Sample 1 , we initially thought our extraction solution would be effective for lysing cells and extracting gDNA. Unfortunately, at the time we were not thinking of the impact SDS and EDTA would have on the polymerase/overall PCR reaction. SDS is a strong detergent that is often used to lyse cells and extract DNA, but is also very good at unfolding proteins. That is not good news for our polymerase. The other problem with sample 1 was the EDTA. Metal ions (specifically Mg2+) are essential co-factors for our polymerase to work correctly. Having too little or too much free Mg2+ can be devastating to a PCR reaction (as we are finding). In our case, the presence of excess EDTA and SDS rendered our reaction, unreactive…

Sample 2 and 3 seemed to work very well with 20mM NaOH and KOH, respectively. The simple colony PCR protocol was a tip given to us by an experienced molecular biologist. We figured that the base would be aggressive enough (but not too aggressive) to lyse cells and make DNA available for extraction. We were right! It felt good to know that that method worked since it’s so cheap and fast.

Sample 4 was expected to fail as the primers were designed for insect DNA amplification.

Sample 5 worked as anticipated. Again, this sample used the Epoch kit, so started with clean plant genomic template DNA.

Sample 6 was a plant prep using 80mM NaOH. It was encouraging to see enough plant DNA could be prepared by such a simple, fast, and cheap method and give comparative amplification to Sample 5, which was prepared using a spin kit costing ~$1.50 per prep.

Sample 7 was a failed ascomycete fungal sample prepared by grinding the sample in 80mM NaOH.

Standard 25uL reaction

1uL template DNA
0.5uL 10uM forward primer
0.5uL 10uM reverse primer
12.5uL NEB Taq 2x Master Mix
10.5uL water

Overall, these 7 samples showed us that out procedure was somewhat reproducible, but we do have some variables to consider looking into. Primer design and PCR conditions for each primer set are definitely worth checking out. Also, maybe our Taq is starting to go bad; we have taken it in and out of the freezer dozens of times, same goes for our primers. We will definitely look into this further.

by Jake

Simple Disc Diffusion Assay

April 19, 2013 in Posts by Jake

 
     
 
 
 
 
 
  
 
 
 
 

This is a simple disc diffusion assay that we conjured up. The aim here is to see the effects an antibiotic has on a bacterial colony. In this case, we plated E.coli on PDA plates with no antibiotics in the media. We made a stock solution of 1mg/mL chloramphenicol in absolute ethanol and soaked small pieces of filter paper in various amounts (0ug, 5ug, 10ug, 20ug and 50ug) and placed them on plates that were freshly coated with E.coli. We incubated at 37C overnight.

The plate on the left is the before shot, prior to incubation. On the right is the plate after incubating at 37C overnight. You can clearly see the growth of E.coli around the 0ug disc (containing no chloramphenicol) and the lack of growth around the discs that do contain chloramphenicol. You can also see that the inhibition of growth is larger next to the 50ug disc versus the 5ug disc, as expected.

It’s also worthy to note that chloramphenicol is a bacteriostatic antibiotic, meaning that it does not kill bacteria, but prevents them from reproducing. If we took a plate that already had a full lawn of E.coli, we wouldn’t see complete absence of colonies after incubation, just less growth from those colonies exposed to the antibiotic. On the other hand, a bactericidal antibiotic (such as penicillin) will in fact kill bacterial colonies.

Overall, this nicely demonstrates how a disc diffusion assay works. In the future, we plan to isolate our own compounds and use this same setup to test for bioactivity and potency of our isolates. Stay tuned…

Below you can see another plate which had no antibiotics in the media and was not exposed to a disc diffusion assay.