by Dakota

Driving around in a van with a LCMS

September 21, 2014 in Posts by Dakota

So I’ve either completely lost my mind or I’ve finally caught a break.  I managed to grab a full LCMS (single quadrupole) system complete with high vacuum pumps and software from some very kind people who believe in me.  Although getting a 400 volt direct line in my parent’s basement won’t be possible, at least I can say I have an LCMS in my home lab, which is cool.  My aunts minivan was cruising through the streets with about 1,000+ lbs of analytical chemistry equipment the other day, which put the breaks to the test.

This isn’t a machine I can run from a home-lab anyway as it requires huge power loads and a steady delivery of nitrogen and helium tanks.  I’m hoping I can find a new home for it and or myself soon! .

 

20140920_122006 20140920_174351 20140920_174301(0)

by Dakota

Scale up week: GRAMS ON GRAMS

September 10, 2014 in Projects by Dakota

Going to be a short post as I’ve been pretty busy in the lab, even sleeping there a few nights so I can wake up and get to it the next day.  I just think of it as practice for graduate school!

Scaled up the acylation reaction and recovered 21g of product which was ~62% yield.  I would have liked it to be a bit higher but I wasn’t using nitrogen and ended up seeing a portion of my acyl halide disappear into HCl fumes due to water vapor.  I really need to get a Schlenk line setup.

I also scaled up the TBS protection reaction but unfortunately was limited by the remaining imidazole catalyst.

I ran the largest flash column I’ve ever run by hand and it was an experience…definitely an art form I’d say which I’m a long way from mastering.  Collecting fractions by hand while trying to keep the solvent level topped off and making sure the column doesn’t explode is something you must balance delicately.

Sadly, a lot of the early fractions had the product I wanted in them (the lowest dot on the TLC plates) alongside the two unwanted side products (2 dots up top).  I managed to snag a bunch more “pure” fractions which I didn’t end up showing, but you can see the final pooled fraction plate on the right.  I still kept the mixed product fractions as a crude testing batch, but it also looks like the “pure” fractions which have what I want have some imidazole catalyst left over, which is causing streaking.  I’ve heard getting rid of imidazole can be a pain, so maybe next time I”ll do more water washes, or throw in some LiCl2 which I think said can remove it more effectively.

While I was waiting I recrystalized some more Meldrum’s acid from a yellowish mess into nice white crystals!

As for the large purple RBF, I’ve read and was told by some people smarter than me that DMAP (http://en.wikipedia.org/wiki/4-Dimethylaminopyridine) can be a product of pyridine catalyzed reactions, even though in some cases it’s actually added as the catalyst.  In my case, I only used pyridine, but I assume because it was in DCM, and with some HCl from acyl halide reacting with residual water…that perhaps it was somehow being formed?

NMR spectra look good, but pictures of them are kind of hard to read from a digital image so I’m not even going to bother posting until maybe the end.

DSCN2056 (2) DSCN2054 DSCN2046 DSCN2045 DSCN2025 DSCN2027 DSCN2031 DSCN2032

by Dakota

Waka-Flaka-Flame would be proud…going hard in the lab

July 28, 2014 in Posts by Dakota

So the past two weeks have been pretty hectic, as I try to assemble some teaching labs for some basic biotech skills such as transformations and PCR, while simultaneously trying to attempt the multi-step synthesis of the first synthetic target for downstream biological testing.   Waiting on chemical suppliers can be slow, but the arrival of our reducing agent and alcohol protecting group means we can move forward with the entire synthesis.  Couple that with the arrival of the high pressure nitrogen tank for the 300Mhz NMR tomorrow, and things for once seem to be going ok in life.

IMG_1750IMG_1749IMG_1745IMG_1743


 

 

 

You can see the successful transformation of DH5a super comp cells from NEB with pGREEN.  The control plate is in the middle, surrounded by smaller LB-Amp plates with pGREEN+ transformants plated out at varying times of outgrowth.   After addition of the SOC outgrowth media, I immediately plated 20uL of the cell suspension, and in other cases I let the cells sit in the media at 37C for 30 minutes, and 1 hour respectively, and plated 20uL.  There did not seem to be any difference in transformation efficiency between the time points (though I know it’s impossible to tell transformation efficiency from those lawns).  I didn’t bother with serial dilutions because I wasn’t concerned with transformation efficiency with pGREEN.

While I was waiting for everything I also brushed up on some gram staining skills, staining  Staphylococcus aureus (little circle shaped bacteria) and E. Coli (the rod shaped bacteria).  

 

DSCN1854DSCN1859DSCN1871DSCN1876

 

 

 

 

 

Since Meldrum’s acid is an important reagent in the first step of the synthesis, it’s important to use as pure a product as can be reasonably obtained to insure high yielding 5′ acylation.  As you can see from the picture on the left, shipped from Sigma it is granular with what looks like yellow/orange impurities.  After dissolving in the minimum amount of hot acetone and allowing to cool, followed by an ice bath, nice long needle-like crystals start to form.  The crystals are recovered via vacuum filtration and you’ll notice the comparable difference between the nice white crystals recovered and the residual yellow/orange waste sitting in the filtrate of acetone.

DSCN1881

I managed to have a nice skype conversation with some prestigious scientists from the John Innes Center in the UK, so if this all fails, I guess it’s time for grad school.  But, I’m staying positive, even though I’m poor  right now.

 

 

 

 

by Dakota

Pyridine catalyzed acylation of Meldrum’s acid en route to a β-keto ester

July 21, 2014 in Posts by Dakota

We’re attempting our first multi-step synthesis and have finally gotten off the chalkboard, out of the notebook, and into the lab.   We’re starting with a small 500mg pilot reaction to make sure everything is in working order before we scale up.  As all of the reagents are being paid for out of pocket, mistakes and wasted reagents can become costly!

Acylation is a standard orgo 1 or 2 lab experiment,  but doing something on paper is different than in a round bottom flask.  The arrival of our acyl halide made moving forward with the (hopefully) 5′ acylation of Meldrum’s acid a possibility.  Not wanting to dump our entire 25g ($40) of Meldrum’s acid in a RBF and go with the literature procedure, we decided to try it out ourselves on a small scale.

IMG_20140717_145936

We started with 500mg of the recrystalized (from acetone) Meldrum’s acid dissolved in 2mL of DCM which had previously been dried over sodium sulfate.  We followed that with 4 eq of pyridine which were added in 200uL batches over a period of about 10 minutes.  Since everything was done on such a small scale, we did not use addition funnels, as adding 700uL of a reagent over 10 minutes would be futile using large glassware.  Instead, we opted for small additions using a p1000 micro pipette, which seemed to work ok.

Our Schlenk line was not setup, and the nitrogen gas wasn’t delivered on time, so we weren’t able to run the reaction under nitrogen like we wanted to.  While not absolutely necessary, it could theoretically improve yields by keeping moister out of the reaction container, which would quickly eat up our acyl halide.

An equimolar equivalence of our acyl halide was added to the reaction after being diluted 4x in dry DCM.  Upon addition of the first small batch of acyl halide, the reaction turns yellowish orange as expected.   Small partitions of 200uL of the acyl halide in DCM are slowly added to the reaction mixture over a period of about 45 minutes, and the solution starts to turn darker orange, then deep red/purple.

IMG_20140717_151023

IMG_20140717_154233

 

 

After the acyl halide was completely added, the reaction mixture stirred for another 30 minutes on ice, then was removed from the ice bath and allowed to stir at room temperature for another 30 minutes.  The reaction mixture was then quenched with 20mL of 2N HCl and the organic layer was removed in a sep funnel.  The aqueous layer was extracted 2x with DCM and the organic layer and DCM extracts were combined.  The combined organic layers were washed with 2N HCl and then with saturated NaCl solution.

They were dried over anhydrous sodium sulfate to yield an orange solution, and excess solvent was removed by rotary evaporation to yield a deep red/orange oil.


IMG_20140717_170755IMG_20140717_173139IMG_20140717_172313

 

TLC was done throughout the reaction, though trying to take pictures of them under UV light was kind of a pain.  We’ll need to develop them with iodine in the future, especially since the acyl halide might not be visible  with just UV as any unreacted acyl halide will probably convert to the carboxylic acid upon touching the silica or just atmospheric moisture.  Hopefully when the NMR is up and running we can make use of though.  I’d like to trust the FTIR we have but…I’m unsure of how accurate it is.

IMG_20140717_175944

 

The big dot all the way to the left is the Meldrum’s acid standard.  The 2nd column is half way through the reaction with 0.5eq Acyl halide added, you can see a dot slightly above the Meldrum’s acid and then a dot town towards the bottom.  The 3rd column is the final extracted and rotovapped product.   Since we’re adding a pretty decent sized alkyl chain, I was thinking the product would be more soluble in the mobile phase, and give a higher spot on the TLC.  You can maybe see that the large dot in the final column is indeed higher than the Meldrum’s acid standard…but I’m not that comfortable in determining the success of the reaction via TLC.  I’ll be happy with a decent NMR, though I’d really like to just be able to fly it in an LCMS.

A lot learned and a lot to learn, I’ll try to make picture quality and video quality better in the future, but I was just in a hurry to get going as I’m sick of waiting around for things.  Take action every day!

by Dakota

Recrystalization of Meldrum’s acid from acetone – Prepping for the pilot reaction

July 10, 2014 in Posts, Projects by Dakota

So the reagents for the synthesis are finally almost all here, last one should arrive today.  While we’ve been waiting for things to arrive we’ve been trying to get the NMR at school back up and running.  A lack of nitrogen for the high pressure tank kept me from running any samples today though sadly, so will have to wait until next Tuesday to see how well it works when the gas is delivered.  It’s sad to see such a nice machine (Varian 300mhz) sit in a dark back room so we’re trying to give it a purpose to come back to life!

IMG_1694

 

IMG_1697IMG_1699IMG_1701IMG_1703IMG_1702

 

 

 

 

 

 

 

From a granular yellow/white powder to pretty nice crystals, the first pass will be enough to test the next step which is acylation of the Meldrum’s acid with an acyl halide.  The conditions call for slow addition of pyridine to the Meldrum’s acid and acyl halide in DCM under inert conditions.  We’ll see how that goes…

 

by Dakota

Streptomyces avermitilis and Streptomyces coelicolor

June 23, 2014 in Posts by Dakota

 

Just a quick update that our donated strain samples are growing!  We don’t have an incubator so we’re making due with a room temperature dark cabinet, so while not optimal, it gets the job done.

We plated our samples of Streptomyces coelicolor and Streptomyecs avermitilis about a week ago, and it seems they have finally undergone formation of aeriel hyphae alongside production of the pigmented polyketide antibiotic actinorhodin (in the case of coelicolor).    One of the plates of coelicolor does not look the same as the other colonies though.  A purple color is being produced by the organism, and they have a much smoother/slimier look to the colonies.  Perhaps they are a day or two away of forming the fuzzy aeriel mycelia, or perhaps they are a mutant.   We will keep an eye on them.

We will be using them in our future work as part of a bio-assay for the compounds we are making.  The one picture of the brown pigment diffusing from the two colonies are those of S. avermitilis, the maker of avermectin.

IMG_1608IMG_1607IMG_1603IMG_1601

 

by Dakota

DNA Barcoding of fungal endophytes followed by DNA sequencing

June 20, 2014 in Endophytes, Posts by Dakota

So while we’re waiting for some reagents to come in for the synthesis of our first chemical product, I’ve been helping to run a class on the natural products of fungal endophytes.  Most of the work we’ve been doing the past few years on our own has been surrounding bio-active secondary metabolites originating from fungal endophytes, inspired mainly by the work of Dr. Gary Strobel of Montana State University.   One of our professors liked the idea enough to actually make it the main focus of one of her courses.  In exchange for our help and the use of some of our equipment, we get access to a University lab space and the associated perks that come with that, like consumables and access to machines we could never afford on our own like a UPLC, NMR, GC-MS and soon an LCMS.

It’s been rewarding, but also stressful at times, as trying to do molecular biology and microbiology in a chemistry lab is…difficult.  We’ve basically had to buy or borrow all the necessary equipment, and sometimes had to get creative.

Nevertheless, with a few setbacks like our -20C freezer failing and ruining all our reagents, we’ve been able to push forward to obtain some sequence data from the ITS (internal transcribed spacer) region of a few isolates the students have made.

The gel above is from students using a quick lysis method which entails a toothpick tip full of mycelia in water followed by incubation at 95C for 3 minutes, then ice until ready for use. The ladder used is a 1kb ladder from NEB. The first two lanes are +controls comparing previous DNA preps of a basidiomycete, followed by student samples.

Only three PCR products were observed on the gel, one being quite faint, in addition to the two controls.  The student who prepped the reaction in lane 7 and 8 seemed to have forgotten template DNA while overloading primer, and forgetting it in the 8th tube…which potentially explains the extremely bright primer cloud and absence of it in lane 8.

Nevertheless, we were still able to get some decent reads and contigs out of the data.

For the band in well 5 – it was a white filamentous ascomycete isolated from garlic.

The contig is as follows if one would like to nucleotide BLAST it.

>Ctg-CM-001
TAGGTGAACCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCC
TGTGAACATACCAATTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAA
CGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTC
TGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTT
CTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCA
GAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTAT
TCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGG
TTTGGTGTTGGGGATCGGCGAGCCCTTGCGGCAAGCCGGCCCCGAAATCT
AGTGGCGGTCTCGCTGCAGCTTCCATTGCGTAGTAGTAAAACCCTCGCAA
CTGGTACGCGGCGCGGCCAAGCCGTTAAACCCCCAACTTCTGAATGTTGA
CCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGG
AGG

It appears to be from Fusarium Proliferatum which, upon a quick morphological check and Google, seems to check out.  I guess that particular species is present as a plant pathogen in garlic bulbs according to google.  With few mycologists around, it’s been hard to positively ID via morphology many of the species.  I can only pick out with confidence Penicillium and Aspergillus species.  I have a better picture on my phone of the spores, but they look like long stretched out footballs and seem to match the spore shape of many fusarium.

95C 3 min initial denature

95C 30s denatration

52C 45s annealing

72C 1 min elongation

Repeat 34x

72C 5 min final elongation

1 uL crude template

2uL ITS1 / ITS4 10uM primer master mix

12.5 uL 2x  Taq NEB Master Mix

9.5 uL water

—–

5uL PCR rxn load onto a 1% agarose gel stained with GelGreen

The other contigs follow below.

>Ctg-CM-002
TCCGTAGGTGAACCTGCGGAGGGATCATTATCGAGTTATTCAACTCCCAA
ACCCTATGTGAACTTACCACTTGTTGCTTCGGCGCGCGCTTCGGCGCCGC
CGAGGACACTTAAACTCTTTGTTTTTATAAGCATTTCTGAGTGGCCGAAA
GGCAAAAATACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCT
GGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGA
ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTC
TGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCCGACTCTT
TTGAGGACGGCTCGGCGTTGGGGGACGGCAGACTCCCCCCGGCATCTCGC
CGGGGACGCCGCCCCCGAAATCTAGTGGCGGCCCTCCGAGGCGACCTCTG
CGTAGTAACTTGTTCTCGCACCGGAAAGCTCAGAGCGGCCACGCCGTAAA
ACCCCAACTTTTTTCAGGTTGACCTCGAATCAGGTAGGACTACCCGCTGA
ACTTAAGCATATCAATAAGCGGAGG

>Ctg-CM-003
TCCGTAGGTGAACCTGCGGAGGGATCATTATCGAGTTATTCAACTTCCAA
ACCCTATGTGAACTTACCACTTGTTGCTTCGGCGCGCGCTTCGGCGCCGC
CGAGGACACTTAAACTCTTTGTTTTTATAAGCATTTCTGAGTGGCCGAAA
GGCAAAAATACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCT
GGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGA
ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTC
TGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCCGACTCTT
TTGAGGACGGCTCGGCGTTGGGGGACGGCAGACTCCCCCCGGCATCTCGC
CGGGGACGCCGCCCCCGAAATCTAGTGGCGGCCCTCCGAGGCGACCTCTG
CGTATTAACTTGTTCTCGCACCGGAAAGCTCAGAGCGGCCACGCCGTAAA
ACCCCAACTTTTTTCAGGTTGACCTCGAATCAGGTAGGACTACCCGCTGA
ACTTAAGCATATCAATAAGCGGAGG

>Ctg-CM-004
GGGGCGCGTCCCGTAGGGGACGGCACCCATCACACAAGCCGGGCTTGAGG
GTTGCAAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGAGGGCGC
AATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTA
CTTATCGCATTTCGCTGCGTTCTTCATCGATGCTGGAACCAAGAGATCCG
TTGTTGAAAGTTTTAATGATTAAATATAATC

>Ctg-CM-005
ATCCGAGGTCAAGACGGTAATGTTGCTTCGTGGACGCGGGCCGCGCACCT
CGAGAAGCGCAATGTGCTGCGCGAGAGGAGGCAAGGACCGCTGCCAATGA
ATTTGGGGCGAGTCCGCGCGCAGAGGCGGGACAGACGCCCAACACCAAGC
AGAGCTTGAGGGTGTAGATGACGCTCGAACAGGCATGCCCCATGGAATAC
CAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCA
ATTCACACTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAGCC
AAGAGATCCATTGTTGAAAGTTGTAACGATTGTTTGTATCAGAACAGGTA
ATGCTAGATGCAAAAAAAGGTTTTGATAGGTTCCAACGGCAGGTTGCCCC
GCCGAAGGAGAACGAAAGGTGCTCGTAAAAAAAGGATTCAGACATGCGGC
GCGTGAAAGTGTTACCTCTACCGCCCGACGGCAGCTGTTGCTCCCGCCGA
GGGCCGCGACCGCACCTCATGGAATAGATAATGATCCTTCCGCAGGTTCA
CCTACGGA

>Ctg-CM-006
CCGTAGGTGAACCTGCGGAGGGATCATTACTGAGTTACCGCTCTATAACC
CTTTGTGAACGTACCTAACCGTTGCTTCGGCGGGCAGGGGAAGCCTCTCG
CGGGCCTCCCCTCCCGGCGCCGGCCCCCACCACGGGGACGGGGCGCCCGC
CGGAGGAAACCAAACTCTATTTACACGACGTCTCTTCTGAGTGGCACAAG
CAAATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGA
AGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAAT
CATCGAATCTTTGAACGCACATTGCGCTCGCCAGCATTCTGGCGAGCATG
CCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGTTTTGGGGCCC
CACGGCCGACGTGGGCCCTTAAAGGTAGTGGCGGACCCTCCCGGAGCCTC
CTTTGCGTAGTAACTAACGTCTCGCACTGGGATCCGGAGGGACTCTTGCC
GTTAAACCCCCAAATTCTTTACAGGTTGACCTCGGATCAGGTAGGAATAC
CCGCTGAACTTAAGCATATCAATAAGCGGAGG

>Ctg-CM-007
CCGTAGGTGAACCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAAC
CCCTGTGAACATACCTTTATGTTGCCTCGGCGGATCAGCCCGCGCCCCGT
AAAACGGGACGGCCCGCCGCAGGAAACCCTAAACTCTGTTTTTAGTGGAA
CTTCTGAGTATAAAAAACAAATAAATCAAAACTTTCAACAACGGATCTCT
TGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAA
TTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCC
AGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCC
AGCTTGGTGTTGGGATCTGTCTTCACTGACAGTCCTCAAATTGATTGGCG
GTCACGTCGAGCTTCCATAGCGTAGTAATTTACACATCGTTACTGGTAAT
CGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATC
AGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGG

by Dakota

Cultivate friendship and do cool science

June 11, 2014 in Posts by Dakota

So the past two weeks have been pretty crazy, in a good way.  I’ve managed to meet up with people from MIT, BOSSLab, and a few local biotechs on the North Shore.  It’s been strange not having to wake up to go to a 9-5.  I wouldn’t say it’s good, because distractions abound, but I was able to meet more people in two weeks in regards to pure science and business development than I ever had in a year prior.  I suppose a 9-5 for someone else is equal to a 9-midnight job you do for yourself.  Being able to meet at any time and anywhere is a good thing when it comes to progressing an entrepreneurial endeavor.  Not being payed while you meet these people, though, is the downside.   I can live with raman noodles and rainwater for now though.

Some people can pull off starting a side-business while working their main job, but I found that starting DNA extractions and PCR’s at 8 pm just wasn’t fun, couple that with spending the weekends in the lab and you felt like you weren’t even living life for someone in their twenties.  Hard work is important, yes, but hard work and torture are two different things.  We only get a finite amount of time on this planet and it can’t all be spent reading journal articles and running gels…human interaction is important to happiness and sanity.

I’d venture to say that starting a biotech company is not something that is easy to moonlight.  Wittling soap into gnomes for beer money might be something you can pull off in your spare time, but multi-step organic synthesis is not.

20140605_181200

We managed to acquire from T.K. an Eppendorf 5417C centrifuge along with some unique bacterial strains for use in a current project.  I have no idea how people feel about their name being used on the internet so I will bypass naming and use just initials.  We also managed to acquire from A.L. the parts for the Lightbulb PCR machine which had been developed over the past year at http://tequals0.wordpress.com/  and http://bosslab.org/

K.G. hooked it up with some E. Coli strains including a ccDB toxin/antitoxin containing strain.

All in all it has been a good two weeks.  Met a lot of really interesting people all doing really inspiring work.  I hope one day we’ll all make it big, and if only one of us make sit big, they’ll help the rest of us out!

But in all seriousness, the point of this post wasn’t just a quick update, but it was to mention the importance of human interaction in achieving what it is you want to achieve.  Humans, by nature, want to help each other.  You’d think if natural selection had its way, everything would be out to kill everything else, but that’s not the way it turned out.  People feel good helping one another, and rightly so.  We are all in this struggle together on Earth, each awkwardly living our own life trying to make it better for ourselves, our friends, and our family…and hopefully strangers once in a while.

So if there is one piece of advice I could give you if you are trying to start your own company, or even just living your life day to day, it would be to cultivate friendship and cultivate kindness.  Random acts of kindness go a long way.   Do something because it is the right thing to do, not because you hope for a reward.

Also attached are random pictures of us making some growth media for transformation experiments, followed by my strain cultivation of three different kinds of oyster mushrooms; king oyster, golden oyster, blue oyster…and last but not least the boxes that contained our $1,200 set of reagents from NEB for our future experiments.  SCIENCE TIME BABY

IMG_1499 IMG_1447 IMG_144620140605_180452


by Dakota

Quitting my job to start a biotech company in the basement

May 16, 2014 in Posts by Dakota

So after years upon years of talk, planning, more talk, and more empty promises to myself and others, I finally took a leap of faith.  At a certain point, you realize that there isn’t anymore time for planning and writing down ideas, action needs to be taken.  Many people, myself included, have let this unattainable goal of  “perfection” completely ruin pursuing dreams and business opportunities.  I’ve come to the conclusion that nothing will ever be perfect.  A product will never be perfect, the timing for entering a market will never be perfect, and perhaps execution of a well written business plan will never be perfect, but that should not deter one from trying.

Many people fear leaving their comfort zone, I know I did, and still do.  It’s easy to become complacent in the comfort of stability and normalcy.  You go to work, get a paycheck, maybe get to travel for a week or two a year, have the weekends off, and everything seems fine.  Some people are perfectly happy living like that, I’m not.  I’d rather sleep in a van and eat raman noodles for a year if it meant a shot at achieving my dreams and goals.

Certain sacrifices no doubt will be made, nights out with friends will now be nights in spent with Excel calculating profit margins and shipping expenses.  That weekend canoe trip with your buddies will be that weekend of experiments in a cramped lab space with no air conditioning, praying for a product yield above 10%.  While your girlfriend sips from a $5 bottle of triple distilled water, you sip from the rainwater you collected last night in an empty cup you found in the dumpster behind Arby’s.

But someday, when you look back at your life in one year, ten years, or fifty years, you’ll be able to say without regret that you took a shot, and that’s more than a lot of people can say.

I guess many people question what it is they want to do in life after finishing college and working for a year or two.  All of a sudden this giant weight which is reality starts to rest on your shoulders, and you realize as each year passes that you haven’t done 1% of all the cool things you had hoped to be doing when you were planning your life for your future self in middle school or high-school.    That trip across the country never happened, backpacking through Europe became backpacking in the woods behind your house with a 30-pack, and winning the Nobel prize while simultaneously becoming a billionaire before 30 doesn’t look like it’s going to happen.

I still have a few years left for that last challenge though…

I plan on documenting the journey via a series of videos, as well as keeping track of how I spend my time, in the hopes that one day it might be of use for someone else.  There are plenty of stories out there of people’s successes, and even failures, but not many people talk about the nitty gritty in between time.  That period of purgatory where you are in limbo between becoming a successful validated business, or disappearing into nothingness.

We’ll see how far the science gets us in our journey, so for now stay tuned for more content, including videos and write-ups about what it is we are actually working on and what we hope to accomplish.

by Dakota

Endophyte isolation followup

August 12, 2013 in Posts by Dakota

 

A few samples were selected for hyphal tipping and pure culture isolation.  Shown, in no particular order, are some of the samples to be taken and re-plated on fresh PDA.   Small pieces of the mycelia were excised with a sterile scalpel and placed in the center of fresh plates.  In some instances, like the dark red pigmented colony growing within a few others, hope of a perfectly pure inoculum wasn’t expected, and instead we were just interested to see what might grow on the plate.

IMG_1228 IMG_1231 IMG_1222 IMG_1235 IMG_1244

IMG_1245

IMG_1234 IMG_1223 IMG_1229 IMG_1236

 

 


 

 

 

 

 

 

 

 

 

 

 

There were instances like the first picture, in which a very homogeneous mycelial mass was obtained, which looks like a pure culture isolation.  We will perform DNA isolation and ITS amplification on some of the select organisms, as well as observe some of them under the microscope.  This week, agar plugs of pure strains will be put into liquid broth to ferment, with the downstream goal of processing the fermentation broth to isolate a crude extract of secondary metabolites to be used for bio-assay guided fractionation.

IMG_1267 IMG_1282 IMG_1285 IMG_1279 IMG_1277 IMG_1273 IMG_1272 IMG_1271 IMG_1269 IMG_1286