DNA Barcoding of fungal endophytes followed by DNA sequencing

So while we’re waiting for some reagents to come in for the synthesis of our first chemical product, I’ve been helping to run a class on the natural products of fungal endophytes.  Most of the work we’ve been doing the past few years on our own has been surrounding bio-active secondary metabolites originating from fungal endophytes, inspired mainly by the work of Dr. Gary Strobel of Montana State University.   One of our professors liked the idea enough to actually make it the main focus of one of her courses.  In exchange for our help and the use of some of our equipment, we get access to a University lab space and the associated perks that come with that, like consumables and access to machines we could never afford on our own like a UPLC, NMR, GC-MS and soon an LCMS.

It’s been rewarding, but also stressful at times, as trying to do molecular biology and microbiology in a chemistry lab is…difficult.  We’ve basically had to buy or borrow all the necessary equipment, and sometimes had to get creative.

Nevertheless, with a few setbacks like our -20C freezer failing and ruining all our reagents, we’ve been able to push forward to obtain some sequence data from the ITS (internal transcribed spacer) region of a few isolates the students have made.

The gel above is from students using a quick lysis method which entails a toothpick tip full of mycelia in water followed by incubation at 95C for 3 minutes, then ice until ready for use. The ladder used is a 1kb ladder from NEB. The first two lanes are +controls comparing previous DNA preps of a basidiomycete, followed by student samples.

Only three PCR products were observed on the gel, one being quite faint, in addition to the two controls.  The student who prepped the reaction in lane 7 and 8 seemed to have forgotten template DNA while overloading primer, and forgetting it in the 8th tube…which potentially explains the extremely bright primer cloud and absence of it in lane 8.

Nevertheless, we were still able to get some decent reads and contigs out of the data.

For the band in well 5 – it was a white filamentous ascomycete isolated from garlic.

The contig is as follows if one would like to nucleotide BLAST it.

>Ctg-CM-001
TAGGTGAACCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCC
TGTGAACATACCAATTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAA
CGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTC
TGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTT
CTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCA
GAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTAT
TCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGG
TTTGGTGTTGGGGATCGGCGAGCCCTTGCGGCAAGCCGGCCCCGAAATCT
AGTGGCGGTCTCGCTGCAGCTTCCATTGCGTAGTAGTAAAACCCTCGCAA
CTGGTACGCGGCGCGGCCAAGCCGTTAAACCCCCAACTTCTGAATGTTGA
CCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGG
AGG

It appears to be from Fusarium Proliferatum which, upon a quick morphological check and Google, seems to check out.  I guess that particular species is present as a plant pathogen in garlic bulbs according to google.  With few mycologists around, it’s been hard to positively ID via morphology many of the species.  I can only pick out with confidence Penicillium and Aspergillus species.  I have a better picture on my phone of the spores, but they look like long stretched out footballs and seem to match the spore shape of many fusarium.

95C 3 min initial denature

95C 30s denatration

52C 45s annealing

72C 1 min elongation

Repeat 34x

72C 5 min final elongation

1 uL crude template

2uL ITS1 / ITS4 10uM primer master mix

12.5 uL 2x  Taq NEB Master Mix

9.5 uL water

—–

5uL PCR rxn load onto a 1% agarose gel stained with GelGreen

The other contigs follow below.

>Ctg-CM-002
TCCGTAGGTGAACCTGCGGAGGGATCATTATCGAGTTATTCAACTCCCAA
ACCCTATGTGAACTTACCACTTGTTGCTTCGGCGCGCGCTTCGGCGCCGC
CGAGGACACTTAAACTCTTTGTTTTTATAAGCATTTCTGAGTGGCCGAAA
GGCAAAAATACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCT
GGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGA
ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTC
TGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCCGACTCTT
TTGAGGACGGCTCGGCGTTGGGGGACGGCAGACTCCCCCCGGCATCTCGC
CGGGGACGCCGCCCCCGAAATCTAGTGGCGGCCCTCCGAGGCGACCTCTG
CGTAGTAACTTGTTCTCGCACCGGAAAGCTCAGAGCGGCCACGCCGTAAA
ACCCCAACTTTTTTCAGGTTGACCTCGAATCAGGTAGGACTACCCGCTGA
ACTTAAGCATATCAATAAGCGGAGG

>Ctg-CM-003
TCCGTAGGTGAACCTGCGGAGGGATCATTATCGAGTTATTCAACTTCCAA
ACCCTATGTGAACTTACCACTTGTTGCTTCGGCGCGCGCTTCGGCGCCGC
CGAGGACACTTAAACTCTTTGTTTTTATAAGCATTTCTGAGTGGCCGAAA
GGCAAAAATACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCT
GGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGA
ATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTC
TGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGAGCCCGACTCTT
TTGAGGACGGCTCGGCGTTGGGGGACGGCAGACTCCCCCCGGCATCTCGC
CGGGGACGCCGCCCCCGAAATCTAGTGGCGGCCCTCCGAGGCGACCTCTG
CGTATTAACTTGTTCTCGCACCGGAAAGCTCAGAGCGGCCACGCCGTAAA
ACCCCAACTTTTTTCAGGTTGACCTCGAATCAGGTAGGACTACCCGCTGA
ACTTAAGCATATCAATAAGCGGAGG

>Ctg-CM-004
GGGGCGCGTCCCGTAGGGGACGGCACCCATCACACAAGCCGGGCTTGAGG
GTTGCAAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGAGGGCGC
AATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTA
CTTATCGCATTTCGCTGCGTTCTTCATCGATGCTGGAACCAAGAGATCCG
TTGTTGAAAGTTTTAATGATTAAATATAATC

>Ctg-CM-005
ATCCGAGGTCAAGACGGTAATGTTGCTTCGTGGACGCGGGCCGCGCACCT
CGAGAAGCGCAATGTGCTGCGCGAGAGGAGGCAAGGACCGCTGCCAATGA
ATTTGGGGCGAGTCCGCGCGCAGAGGCGGGACAGACGCCCAACACCAAGC
AGAGCTTGAGGGTGTAGATGACGCTCGAACAGGCATGCCCCATGGAATAC
CAGGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCA
ATTCACACTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAGCC
AAGAGATCCATTGTTGAAAGTTGTAACGATTGTTTGTATCAGAACAGGTA
ATGCTAGATGCAAAAAAAGGTTTTGATAGGTTCCAACGGCAGGTTGCCCC
GCCGAAGGAGAACGAAAGGTGCTCGTAAAAAAAGGATTCAGACATGCGGC
GCGTGAAAGTGTTACCTCTACCGCCCGACGGCAGCTGTTGCTCCCGCCGA
GGGCCGCGACCGCACCTCATGGAATAGATAATGATCCTTCCGCAGGTTCA
CCTACGGA

>Ctg-CM-006
CCGTAGGTGAACCTGCGGAGGGATCATTACTGAGTTACCGCTCTATAACC
CTTTGTGAACGTACCTAACCGTTGCTTCGGCGGGCAGGGGAAGCCTCTCG
CGGGCCTCCCCTCCCGGCGCCGGCCCCCACCACGGGGACGGGGCGCCCGC
CGGAGGAAACCAAACTCTATTTACACGACGTCTCTTCTGAGTGGCACAAG
CAAATAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGA
AGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAAT
CATCGAATCTTTGAACGCACATTGCGCTCGCCAGCATTCTGGCGAGCATG
CCTGTTCGAGCGTCATTTCAACCCTCAAGCACCGCTTGGTTTTGGGGCCC
CACGGCCGACGTGGGCCCTTAAAGGTAGTGGCGGACCCTCCCGGAGCCTC
CTTTGCGTAGTAACTAACGTCTCGCACTGGGATCCGGAGGGACTCTTGCC
GTTAAACCCCCAAATTCTTTACAGGTTGACCTCGGATCAGGTAGGAATAC
CCGCTGAACTTAAGCATATCAATAAGCGGAGG

>Ctg-CM-007
CCGTAGGTGAACCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAAC
CCCTGTGAACATACCTTTATGTTGCCTCGGCGGATCAGCCCGCGCCCCGT
AAAACGGGACGGCCCGCCGCAGGAAACCCTAAACTCTGTTTTTAGTGGAA
CTTCTGAGTATAAAAAACAAATAAATCAAAACTTTCAACAACGGATCTCT
TGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAA
TTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCC
AGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCC
AGCTTGGTGTTGGGATCTGTCTTCACTGACAGTCCTCAAATTGATTGGCG
GTCACGTCGAGCTTCCATAGCGTAGTAATTTACACATCGTTACTGGTAAT
CGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATC
AGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGG

0 replies

Leave a Reply

Want to join the discussion?
Feel free to contribute!

Leave a Reply

Your email address will not be published. Required fields are marked *