fungal PCR gel

Down n’ Dirty sequencing

We’ve done enough PCR on fungal cultures and samples to know that our PCR program, enzymes, and primers are working as intended.  In order to give us confidence in the ITS amplification of  unknown endophytic fungal samples, we wanted to amplify a known species and confirm that we can get clean sequencing reads.

We performed a DNA extraction using our homemade buffers and an  isopropanol precipitation  followed by a 50uL PCR reaction.

PCR reaction conditions are as follows:

3uL template

2 uL ITS master mix (ITS1F, ITS4R – see older posts for primer sequences)

25uL NEB Taq Master Mix

20uL water

 

IMG_1143 IMG_1137

 

 

 

 

 

After the reaction was run, a 1% agarose gel was cast, and 5uL of the PCR reactions were loaded, alongside a 1kb NEB ladder.  https://www.neb.com/products/n3232-1-kb-dna-ladder

Lanes were as follows:

1 – NEB 1kb ladder

2 – + control

3 – Sample 1

4 – Sample 2

5 – Sample 1 genomic DNA (5uL load)

fungal PCR gel

 

~40 uL was withdrawn from the sampletube taking care not to get mineral oil, and processed with an Epoch Life Science PCR purification spin kit.

http://www.epochbiolabs.com/pcrcleanup.asp?pageName=products

Eluted DNA and a fresh set of primers were sent for sequencing, although due to very odd circumstances, only Lane 4 (faint band at ~700 bp) arrived.

Sequencing was provided by Wyzer Biosciences in Cambridge, MA  https://www.wyzerbio.com/wiser/#aboutUs

We highly recommend them!  They went above and beyond in order to assure we got quality sequencing data as well as went out of their way to personally call us and discuss sequencing parameters after our primers did not arrive, even with a sample order size of two.  The company is run by fantastic people and is well worth supporting.

Here are the FASTA files as follows.

>23331_2_PR-002_141272_00 4D1000002363964D
NNNNNNNNNNNNNNNNNNNNNCNGNNTTGAGGTCAGCATTCAAGAANTTG
TCCTTAGACGATTAGAAGCTGAACATCAGAAAGCAATCCCCTCGCCAGTG
TAGATAAGTTATCACACTTGTGGCAGATCGCAGACGATTCCGCTAATGCA
TTTCAGAGGAGCTGACCCCAAGTAAGGAGCCAGCAAACCTCCACAATCCA
AGCTCTCCTTTACAACAAAGTATTGGAGAGTTGAGAATATAATGACACTC
AAACAGGCATGCTCCTCGGAATACCAAGGAGCGCAAGATGCGTTCAAAGA
TTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCT
GCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGCTGAAAGTTGTAT
AATAATTTTCATAGGCATAGCCCATGTAAAGACATTCAATGACATTCTAA
GAGTATAATGAATAACATAGACTCTAACAGGAAAAAGATTCCATGGCCAA
GGTAAAGGACAGCACTGTTTTCACACTGCAAGTCCTTACATCCAGCAAAG
AGCTGATAGGCTGACCACTTCCTCCAATACCTGAAAAAGACTACAAAAGG
TGCACAGGTGGATGAAAATGAAGTCCAGACAGGCGTGCACATACTCCGAA
GAGCCAGCTACAACCCATCTAGAAAACATAATTCAATAATGATCCTTCCG
CAGGTTCACCTACGGAA

>23331_2_PR-002_141269_00 4D1000002358244D
NNNNNNNNNNNNNNNNNNNNANNTGGGTTGTAGCTGGCTCTTCGGAGTAN
GTGCACGCCTGTCTGGACTTCATTTTCATCCACCTGTGCACCTTTTGTAG
TCTTTTTCAGGTATTGGAGGAAGTGGTCAGCCTATCAGCTCTTTGCTGGA
TGTAAGGACTTGCAGTGTGAAAACAGTGCTGTCCTTTACCTTGGCCATGG
AATCTTTTTCCTGTTAGAGTCTATGTTATTCATTATACTCTTAGAATGTC
ATTGAATGTCTTTACATGGGCTATGCCTATGAAAATTATTATACANCTTT
CANCAACGGATCTCTTGGCTCTCGCATCNATGAANAACNCNNCGNANNNN
NATAANNNNTGNNNNTTGCANANNTCNNNGNTCNTCAAANNNTTNAANNN
TNTTGCGCTNNNNGNNANTCNNANNANNN

Put them into

http://blast.ncbi.nlm.nih.gov/

dd2f41d6a39848cb905f1b93b4a39a4d

 

Our sequencing chromatograms looked good, with one giving a read of over ~700 bases, while the other was cut short at ~400 bases.  Nevertheless, for a first try the very crude attempt at sequencing went better than expected, and enough data was retrieved to give a greater than 99% confirmation on the sample sequenced via BLAST. We did indeed do ITS amplification of Agaricus Bisporus, and the sequencing data confirms that our protocols for DNA isolation, amplification, and purification are working as intended, and lend confidence to future endeavors in the identification of unknown fungal endophytes.

 

2 thoughts on “Down n’ Dirty sequencing”

  1. Great stuff! You might want to try skipping the DNA purification; we find it usually works for ITS of endophytes just fine. We’ve played with adding enzymes to a bit of hyphae but found that it works in water, too. I usually put 20 ul water into a PCR tube and then use that tip to grab a smear of hyphae. We heat it in a thermocycler to 90 C for ten min five times and then use 1 uL of that as the template for the PCR rxn.

    1. Hey Dan, trying to revive the website and my research. I’ve been doing a LOT of PCR lately and everything has been failing. It’s been quite frustrating. I’ve been using hyphae directly from plates, grinding some in NaOH, grinding some in water, grinding some in TRIS, then using that directly, or heating at 95C for 3-5 minutes.

      In a 50uL reaction I’ve been using 5uL template DNA, 1uL 10uM primers ITS1 and ITS4, 25 uL Taq2x Master Mix from NEB, and water to volume. Tried everything from increasing initial degredation time to 10 minutes to lowering and raising annealing temps. The Taq is brand new so isn’t bad, and primers have worked before numerous times, so I don’t know what’s going wrong. Our GelGreen could be going bad but the ladders have been staining fine, albeit quite low intensity.

      Colony PCR from mycelia seems like it should be easy, as you don’t really need much DNA to get things to work, so I don’t know what the heck is wrong. I need to re-approach it with a more scientific approach and get some good highly purified DNA to use as a control. I’ve been king of winging it and rushing experiments as I usually do them after work and time is short. Do you have a protocol that consistently works? The one you mentioned, heating it for 50 minutes at 90C, that doesn’t lead to DNA degradation?

Leave a Reply

Your email address will not be published. Required fields are marked *

* Copy This Password *

* Type Or Paste Password Here *

You may use these HTML tags and attributes: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <s> <strike> <strong>